NCERT Solutions of Class-12 Biology Chapter-5: Molecular Basis of Inheritance
Last Updated : 09 May, 2024
Molecular Basis of Inheritance Class 12 NCERT Solution is all about the process of inheritance at the molecular level. These NCERT Solutions are prepared by our Top Biology Experts in order to take care of all Important Topics that might be asked in the upcoming examination 2023. So, Students can also refer to these solutions for their final Examination preparation.
This Class 12 Biology Chapter 2 Molecular Basis of Inheritance NCERT Solutions are carefully developed using easy-to-understand language while adhering to the guidelines for solving NCERT Chapter-Wise Solutions for Class-12. Working through these solutions can be highly beneficial for students in their board exams, as well as in preparing for future competitive Exams.
Molecular Basis of Inheritance Class 12 Questions and Answers
NCERT CBSE Chapter 05 Molecular Basis of Inheritance of Class 12 explains about the genetic material i.e., DNA, inheritance pattern, and genetic basis of those patterns. The basic knowledge of DNA and RNA, how genetic information transfers from one generation to the other. Revise the basic concepts of the Molecular Basis of Inheritance for quick revision and class notes.
Q1: Group the following as nitrogenous bases and nucleosides:
Adenine, Cytidine, Thymine, Guanosine, Uracil, and Cytosine.
Answer:
A Nitrogenous base is a molecule that contains nitrogen and has the chemical properties of a base. So, among the molecules listed above, Adenine, Cytosine, Uracil & Thymine are called nitrogenous bases because they contain nitrogen atoms. The lone pairs of electrons on these nitrogen atoms are critical for binding DNA together.
Whereas, the molecules, Cytidine & Guanosine mentioned above fall in the group of Nucleosides because they are made of a nitrogenous base and a five-carbon carbohydrate ribose.
Q2: If a double-stranded DNA has 20% of cytosine, calculate the percent of adenine in the DNA.
Answer:
According to Chargaff's rules, the amount of adenine(A) is equal to the amount of thymine(T) and the amount of cytosine(C) is equal to the amount of guanine(G).
So, A = T and G = C
Hence if a dsDNA has 20% cytosine, then the amount of guanine will be the same i.e. 20% (G + C = 40%) Thus the remaining 60% will be formed by the remaining base pairs i.e. adenine and thymine. [A + T = 60%, (30% each)]
Hence the amount of Adenine in a dsDNA is 30%.
Q3. If the sequence of one strand of DNA is written as follows:
5'-ATGCATGCATGCATGCATGCATGCATGC-3'
Write down the sequence of the complementary strands in the 5'→ 3' direction.
Answer:
Adenine always pairs with thymine and cytosine always pairs with guanine. So, if the sequence of DNA is
5'-ATGCATGCATGCATGCATGCATGCATGC-3'
The sequence of the complementary strand will be
3`- TACGTACGTACGTACGTACGTACGTACG - 5`.
So, in a 5' - 3' strand, it would be
5'- GCATGCATGCATGCATGCATGCATGCAT-3'
Q4. If the sequence of the coding strand in a transcription unit is written as follows:
5'-ATGCATGCATGCATGCATGCATGCATGC-3'. Write down the sequence of mRNA.
Answer:
If the sequence of the coding strand in a transcription unit is
5’- ATGCATGCATGCATGCATGCATGCATGC-3’
Then, the template strand in a 3’ to 5’ direction would be
3’ – TACGTACGTACGTACGTACGTACGTACG-5’
As we all know that the sequence of mRNA is the same as the coding strand of DNA. But in RNA, Uracil replaces thymine. Hence, the sequence of mRNA will be
5’- AUGCAUGCAUGCAUGCAUGCAUGCAUGC-3’
Q5: Which property of DNA double helix led Watson and Crick to hypothesize a semi-conservative mode of DNA replication? Explain.
Answer:
The complementary base pairing property of DNA double helix led Watson & Crick to hypothesize a semi-conservative mode of DNA replication. Semi-conservative mode of replication produces two copies, each containing one original strand and one new strand. This means that every double helix in the new generation of an organism consists of one complete “old” strand and one complete “new” strand wrapped around each other.
Q6: Depending upon the chemical nature of the template (DNA or RNA) and the nature of nucleic acids synthesized from it (DNA or RNA), list the types of nucleic acid polymerases.
Answer:
There are two different types of nucleic acid polymerases:
- DNA-dependent DNA polymerases
- DNA-dependent RNA polymerases
- RNA-dependenta RNA polymerase
- RNA-dependent DNA polymerase
Q7: How did Hershey and Chase differentiate between DNA and protein in their experiment while proving that DNA is the genetic material?
Answer:
Hershey & Chase cultured bacteriophage in two different media. One contained radioactive phosphorus (32P) and the other media contained radioactive sulfur (35S). Phosphorous is a component of the nucleotides and it forms the nucleic acid whereas sulfur is a component of amino acids methionine and cysteine, that form the protein. Now the two samples of bacteriophage were allowed to infect its host cell i.e., E. coli. After infection, the samples were analyzed for radioactivity in the host cells. For analysis, the virus and bacteria were separated via centrifugation. Since the protein coat was lighter, it was found in the supernatant while the infected bacteria got settled at the bottom of the centrifuge tube. Hence, it was proved that DNA is the genetic material as it was transferred from virus to bacteria.
Q8: Differentiate between the followings:
a) Repetitive DNA & satellite DNA
b) mRNA & tRNA
c) Template strand & Coding strand
Answer:
a) Difference between repetitive DNA & Satellite DNA:
Repetitive DNA | Satellite DNA |
Repetitive DNA are tandem repeats or interspersed repeats | Satellite DNA is micro-satellite or mini-satellite |
Repetitive DNA forms light bands. | It forms small dark bands. |
It doesn't show polymorphism. | Shows polymorphism. |
b) Difference between mRNA & tRNA:
mRNA | tRNA |
It forms the connection between genes & protein | It provides correct amino acids to the ribosomes. |
It has a linear structure | It has a cloverleaf structure. |
It carries genetic information from the nucleus to the ribosome | It carries amino acids to ribosomes. |
It consists of codons. | It consists of anticodons. |
c) Difference between Template strand & Coding Strand:
Template Strand | Coding Strand |
Template strand refers to the DNA sequence that can duplicate itself during mRNA synthesis. | The coding strand is the DNA strand whose base sequence is similar to its primary transcript (RNA). |
It runs from 5’ to 3’ | It runs from 3’ to 5’ |
It contains anticodons. | It contains codons. |
Q9: List two essential roles of the ribosome during translation.
Answer:
Ribosomes have the following roles during translation:
- Responsible for protein synthesis.
- Act as a catalyst during the formation of peptide bonds.
Q10: In the medium where E. coli was growing, lactose was added, which induced the lac operon. Then, why does the lac operon shut down sometime after the addition of lactose in the medium?
Answer:
Lac operon is a segment of DNA that works in a coordinated manner to metabolize lactose into galactose & glucose. As mentioned above, the lac operon acts as an inducer. So, it binds to the repressor & inactivates it leading to RNA polymerase binding to the promoter region. Hence, three structural enzymes express their product & respective enzymes are produced. After some time when the level of the inducer decreases, it causes the synthesis of repressor from the regulator gene. Now repressor binds to the operator gene & prevents RNA polymerase from transcribing the operon. Hence, the transcription is stopped.
Q11: Explain (in one or two lines) the function of the following:
a) Promoter
b) tRNA
c) Exons
Answer:
Functions of the following:
- Promoter: A promoter is a region of DNA that helps in initiating the process of transcription. It serves as the binding site for RNA polymerase.
- tRNA: It acts as an adapter molecule for linking amino acids to its specific codon present in mRNA.
- Exons: Exons are the protein-coding sequences of RNA that serve to carry genetic information from DNA to proteins.
Q12: Why is the Human Genome project called a mega project?
Answer:
The human genome project is called a mega project because:
- The sequencing of each and every nucleotide base pair present in the human genome took around 13 years it's complete.
- The aim of this project was to develop new technology and new information in the field of genomic studies.
- It was a large-scale project and provided opportunities in the field of genetics, biotechnology, and medical sciences.
- Also, it provided clues regarding the understanding of human biology. Hence, it was considered a mega project.
Q13: What is DNA Fingerprinting? Mention its application.
Answer:
DNA fingerprinting is a technique that shows the genetic makeup of living things. It is a method of finding the difference between the satellite DNA regions in the genome.
Application of DNA Fingerprinting is:
- It is used in forensic science to identify potential crime suspects.
- It is used to establish paternity and family relationships.
- It is used to identify and protect the commercial varieties of crops and livestock.
- It is used to find out the evolutionary history of an organism and trace out the linkages between groups of various organisms.
Q14: Briefly describes the following:
a) Transcription
b) Polymorphism
c) Translation
d) Bioinformatics
Answer:
- Transcription: The process by which a cell makes an RNA copy of a piece of DNA. This RNA copy, called messenger RNA (mRNA), carries the genetic information needed to make proteins in a cell. It carries the information from the DNA in the nucleus of the cell to the cytoplasm, where proteins are made.
- Polymorphism: Polymorphism means "many forms", and it occurs when we have many classes that are related to each other by inheritance. Inheritance lets us inherit attributes and methods from another class. Polymorphism uses those methods to perform different tasks.
- Translation: Translation is the process of translating the sequence of m RNA into a sequence of amino acids. Translation takes place during protein synthesis.
- Bioinformatics: Bioinformatics is an emerging branch of biological science that emerged from the combination of both biology and information technology. It is an interdisciplinary field of study that uses Biology, Chemistry, Mathematics, Statistics, and Computer Science that have merged to form a single discipline. Bioinformatics is mainly used to extract knowledge from biological data through the development of algorithms and software.
Similar Reads
CBSE Class 12 Biology Syllabus NCERT Class 12 Biology Syllabus: NCERT Class 12 Biology Syllabus covers important topics that provide students with a comprehensive understanding of living organisms, their structure, function, and behavior. These notes introduce fundamental concepts of biology including Sexual reproduction in Flowe
4 min read
CBSE Class 12 Biology Notes CBSE Class 12 Chapter-wise Notes Biology helps students to score well in their board examinations. Class 12 Biology is a subject that comes with a wide range of topics, which include inheritance, evolution, reproduction, human health and disease, biotechnology, Ecosystem, and Biodiversity and Conser
4 min read
Chapter 1: Sexual Reproduction In Flowering Plants
Parts of a Flower and Their FunctionsA flower is the reproductive structure of angiosperm that facilitates sexual reproduction. The 4 main parts of the flower include - sepals, petals, stamens (male parts of the flower), and carpels (female part of the flower). The different parts of the flower have their unique function. The primary f
9 min read
Pollen Grains​Pollen grains are minute structures of varying size and shape that contain the androecium, the male reproductive organ of a flower. Pollen grains are also called microgametophytes. The formation of pollen grains occurs through the process of microsporogenesis and consists of a protective outer laye
5 min read
The Structure and Functions of PistilIn flowering plants, sexual reproduction is a complex process that involves the mating of male and female gametes to create seeds for the following generation. The pistil, which is located in the centre of the flower, is the female reproductive structure in flowering plants. What is Pistil?A pistil
4 min read
PollinationPollination is the biological process by which pollen from the male part of the flower transfers to the female part of the same or on different flowers. Pollination results in fertilization and the production of seeds. Pollination is important for the reproduction of plants. Pollination can occur in
6 min read
Double Fertilization: Process & SignificanceDouble fertilization is a unique reproductive process that occurs in flowering plants (angiosperms). Unlike in most other organisms where a single sperm fertilizes an egg, in double fertilization, one male gamete fertilizes the egg cell to form the embryo, while another male gamete fuses with two po
8 min read
Post FertilizationPost-fertilization events are the processes that occur after the fusion of the male and female gametes during sexual reproduction. These post-fertilization events in flowering plants are crucial for the development of the zygote into a mature seed or fruit. Understanding post-fertilization events in
6 min read
Apomixis and Polyembryony: Differences, Types, SignificanceApomixis and polyembryony are two different but related biological processes that result in the production of offspring without fertilization. Apomixis is a type of asexual reproduction where seeds are produced without gametic fusion. While polyembryony is a process in which multiple embryos are pro
5 min read
Chapter 2: Human Reproduction
NCERT Notes on Human Reproduction Class 12 Chapter 2NCERT Notes of Class 12 Chapter 2 Human Reproduction: Human reproduction is the biological process by which a new individual offspring is produced from one or two parent organisms. The Human Reproduction process involves the fusion of gametes, which are specialized cells that carry genetic informati
15+ min read
Gametogenesis - Spermatogenesis and OogenesisGametogenesis is a process of producing male and female gametes, carried out by all sexually reproducing organisms. The process involves various multiple stages of division and differentiation and is highly regulated under hormonal control. GametogenesisGametogenesis produces male and female gametes
4 min read
Menstrual CycleIn a day-to-day existence cycle, a lady's body is powerless against different changes. The pattern of these progressions happens in ladies consistently, emphatically for pregnancy is known as the feminine cycle. At the point when an ovum is unfertilized, the uterus lining sheds and prompts a dischar
9 min read
Fertilizations And ImplantationFertilization and implantation are the 2 important events in human reproduction, which is the biological process of producing new individuals from a union of male and female gametes. This complex process involves the fusion of gametes, the development of a zygote, and the growth and differentiation
5 min read
Embryo Development - Development Process of FetusBirth gives process to a child is known as reproduction. A species' survival depends on its ability to reproduce. There are two different ways to reproduce: Sexual reproduction is asexual reproduction. Asexual reproduction is a type of reproduction that occurs without the involvement of 2 parents. A
5 min read
Parturition And Lactation - Biology Notes Class 12Parturition And Lactation: Several intricate physiological processes, such as fertilisation, implantation, gestation, and delivery, are involved in human reproduction. The act of giving birth, often referred to as parturition, is a significant occasion that signals the conclusion of pregnancy and th
4 min read
Chapter 3: Reproductive Health
Notes on NCERT for Class 12 Biology Chapter 3 Reproductive HealthNotes on NCERT for Class 12 Biology Chapter 3 Reproductive Health: Reproductive health simply means people in a society living with physically and functionally normal reproductive organs and normal behavioral and emotional responses toward sex-related matters. According to WHO “reproductive health m
10 min read
Population Stabilization And Birth Control - Class 12Population Stabilization And Birth Control: Reproductive Health means total well-being in all aspects of reproduction, i.e., physical, emotional, behavioral, and social. Counseling and raising awareness among people about reproductive organs, adolescence, and associated changes, safe and hygienic se
6 min read
Medical Termination of Pregnancy (MTP)Medical termination of Pregnancy (MTP) is an intentional or voluntary termination of pregnancy before its full term. Before the 1960s, surgical methods like vacuum aspiration or dilatation and curettage were common, but medication has since emerged as an alternative option. Medical Termination of Pr
5 min read
Chapter 4: Principles Of Inheritance And Variation
Principles of Inheritance and Variation CBSE Notes for Chapter 4Inheritance is the term given to the process by which characters are passed from parents to offspring which forms the basis of heredity. Heredity is the process of passing down genetic traits from parents to offspring. The degree of difference in characters between a parent and offspring is called v
15 min read
Mendel's Laws of Inheritance | Mendel's ExperimentsMendel's law of inheritance states that offspring inherited from their parents that results in similar characteristics of parents and offspring. This law of inheritance depends upon three other laws including the law of dominance, the law of segregation, law of independent assortment. Gregor Mendel
8 min read
Inheritance of One Gene NotesWe never wonder why Lion can give birth to Lions only, or why a bird can reproduce in the same species and no other species. Not everything is possible, Isn't it? Also, No human being look exactly identical, even with twins there are differences in every individual. Some siblings look similar while
6 min read
Chromosomal Theory of InheritanceThe essential idea behind the chromosomal theory of inheritance is that genes are located on chromosomes and that the behavior of chromosomes during meiosis and fertilization provides the basis for inheritance patterns. In the early 1900s, pioneering geneticists Walter Sutton and Theodor Boveri form
6 min read
Linkage And Recombination - Principles Of Inheritance And Variation Class 12 NCERTCBSE Class 12- Principles Of Inheritance And Variation- Linkage And Recombination: Linkage and recombination are the phenomena that describe the inheritance of genes. Linkage and Recombination both are related to the genetic information inherited from parents to offspring. Linkage is the tendency of
6 min read
What is Polygenic Inheritance?Polygenic inheritance is a type of inheritance in which multiple genes control the phenotype of an organism. The phenotypes or traits can be height, skin color, the color of the eyes, etc. This type of inheritance is also known as quantitative inheritance or multifactorial inheritance. Such traits a
7 min read
MutationThe human body might be visualized as a simple organism. But it is the combination of different complex processes. From the outside, a human body might resemble a very simple one. A body that has two arms, two legs & one head for monitoring purposes. But from the inside of the body, there are ma
15+ min read
Chromosomal Disorders: Principles of Inheritance And Variation Class12CBSE Class-12 Principles Of Inheritance And Variation - Chromosomal Disorders: The chromosomes are thread-like structures that are mainly present in the nucleus which carries the hereditary information of genes that are passed from the parents to the offspring. Due to some irregularities of cell div
5 min read
Chapter 5: Molecular Basis Of Inheritance
Evolution Notes for Class 12 Chapter 6Evolutionary biology is the study of the evolutionary processes that produced the diversity of life on Earth. Earth came into existence sometime between 4 and 5 billion years ago. Life evolved on planet Earth about 3.5 billion years ago. Since then, approximately 15 million different species of orga
11 min read
Molecular Basis of Inheritance Notes Class 12CBSE Class 12 Molecular Basis of Inheritance: Inheritance is transmitted by certain molecules that Mendel termed as ‘factors’, but their nature was discovered later with the development of various scientific techniques. The molecules which govern the inheritance are called genes and it is of two typ
15+ min read
DNA: Structure, Types, and FunctionsDNA structure is made of nucleotide base pairs (other than RNA). DNA is the hereditary material that is possessed by all the organisms found on the Earth except certain virus species. DNA functions involve the transfer of genetic information from generation to generation. The full form of DNA is Deo
11 min read
Packaging of DNA Helix: Histones & ImportanceDNA packaging refers to the process through which DNA molecules are tightly compacted into a smaller volume so that they can fit into the nucleus of a cell. DNA packaging is important because the length of DNA molecules is much greater than the size of the cell nucleus, and therefore, if the DNA wer
5 min read
Search For Genetic MaterialThe search for genetic material has been important in understanding inheritance and evolution. Scientists have explored various models and experiments to identify the substance responsible for transmitting hereditary traits. From Griffith's transformation experiments to Avery, MacLeod, and McCarty's
5 min read
Difference Between DNA and RNAThe difference Between DNA and RNA lies in their structure, function, and location within cells, with DNA typically double-stranded, storing genetic information in the nucleus, while RNA is generally single-stranded, involved in protein synthesis, and present in various cellular compartments. DNA (D
6 min read
RNA - Definition, Structure, Types and FunctionsRNA is a ribonucleic acid that helps in the synthesis of proteins in our body. This nucleic acid is responsible for the production of new cells in the human body. It is usually obtained from the DNA molecule. RNA resembles the same that of DNA, the only difference being that it has a single strand u
11 min read
DNA ReplicationDNA replication is a fundamental biological process by which a cell duplicates its entire DNA. DNA is a self-replicating structure and the replication is catalyzed by enzymes. Through DNA Replication, genetic information is passed on from one generation of cells to the next during cell division. It
8 min read
The Experimental Proof Of DNA ReplicationThe process by which cells duplicate their genetic material during cell division—the replication of DNA—was still largely a mystery. This sparked a race to understand how DNA replication happens among several well-known experts. The experimental evidence of DNA replication, which showed that DNA rep
5 min read
Transcription of DNATranscription of DNA is a cellular process where the genetic information encoded in DNA is converted into RNA. It initiates with RNA polymerase binding to the DNA at a specific promoter region. Then, the enzyme unwinds the DNA and synthesizes a complementary RNA strand by following the DNA template.
6 min read
Genetic Code - Molecular Basis of InheritanceCBSE Class12- Molecular Basis Of Inheritance- Genetic Code: The sequence of nucleotides in deoxyribonucleic acid and ribonucleic acid which determines the amino acids sequence of proteins is known as Genetic code. DNA consists of information for protein sequences. RNA consists of four nucleotides: a
5 min read
Genetic Code and MutationsGenetic code and mutations are important to understand and explain the central dogma of biology. The set of rules governing how DNA sequences are translated into proteins is the genetic code. The four nucleotide bases adenine (A), thymine (T), guanine (G), and cytosine (C), which are organized in pa
5 min read
tRNA - the Adapter MoleculetRNA is also known as transfer RNA is a subtype of RNA, tRNA help in the protein synthesis process. tRNA carries the amino acid to the ribosome, which is the molecular machine that assembles the protein, and ensures that the amino acid is incorporated into the growing protein chain in the correct or
5 min read
RNA TranslationThe Central Dogma, claims that once "information" has transferred into protein, it cannot be retrieved. In greater detail, information transmission from nucleic acid to the nucleic acid or nucleic acid to protein may be conceivable, but transfer from protein to protein or protein to nucleic acid is
15+ min read
Lac OperonLac operon consists of the genes that are required for the metabolism of lactose in a bacterium E. coli and some other enteric bacteria. The name Lac operon actually stands for lactose operon. Lac operon works only when the nutrient source lacks glucose and has only lactose as it takes more steps to
7 min read
Human Genome ProjectHuman Genome Project was the world’s largest collaborative biological project that gave us the ability to examine the full genetic manual for creating a human being in nature. HGP was international scientific research that mainly aims to determine the base pairs that make human DNA, as well as the i
9 min read
What is DNA Fingerprinting?DNA Fingerprinting is a technique used to identify individuals by analyzing their unique DNA patterns. Studying the DNA Fingerprinting steps and process helps in understanding genetic relationships, solving crimes, and identifying individuals based on their unique DNA profiles. In this article, we w
10 min read
Chapter 6: Evolution
Origin of LifeThe origin of life on earth is one of the mysteries to mankind. According to a common man, life is gifted by god whereas scientists believe that life has originated from non-living matter by natural means. This mystery of whether life originated from non-living matter was solved by scientists Pirie.
4 min read
Evolution Of Life Forms – A TheoryEvolution is a process of gradual changes in the heritable characteristics of a biological population, over successive generations, over a long period. (Population: - It is a group of individuals of the same species who live in the same area and can interbreed) Theories of EvolutionTill now, several
5 min read
Understanding Adaptive Radiation: Evolutionary Diversification ExplainedAdaptive radiation is a phenomenon observed in evolutionary biology, that involves the rapid diversification of species into various forms to exploit new ecological niches. This process leads to the exposure of multiple species with distinct adaptations, enhancing their survival in diverse environme
4 min read
Hardy-Weinberg PrincipleA system of guidelines for genetic inheritance is known as mendelian inheritance. A monk by the name of Gregor Mendel made the initial discoveries of genetics in the 1850s, and his findings were first published in 1866. People have been aware of how qualities are passed on from parents to their offs
13 min read
Evolution Of Humans - History, Stages, Characteristics, FAQsHumans, or Homo sapiens, are a species of upright-walking beings known for their cultural diversity, inhabiting the Earth's surface. Believed to have originated in Africa around 315,000 years ago, human evolution is a complex process involving the development of traits such as bipedalism and languag
6 min read
Chapter 7: Human Health and Disease
NCERT Notes on Class 12 Biology Chapter 7 - Human Health and DiseaseNCERT Chapter 7 of Class 12 Notes on Human Health and Disease: According to the World Health Organisation, health can be defined as a state of complete physical, mental, and social well-being and not merely the absence of disease and infirmity. Good health has many benefits like it helps to keep us
15+ min read
Common Diseases In HumansDisease: - A disease is a physiological condition in which the human body fights against the external or internal causes of infection. On the basis of externally caused diseases, various examples are present, ranging from bacteria, viruses, protozoans, helminths, and many more. Pathogen: - The patho
5 min read
Immunity - Definition, Types and VaccinationImmunity is a defense mechanism of the body that is provided by the immune system and helps in fighting disease-causing organisms. There are two immunity types: innate and acquired immunity. Immunity-enhancing foods help boost the body's immune system Vaccination also enhances immunity by exposing t
11 min read
Innate And Acquired ImmunityThe immune system fights against germs and foreign substances on the skin, in the body's tissues, and in bodily fluids such as blood. The overall ability of the host to fight the disease-causing organisms conferred by the immune system is called Immunity. The immune system can be broadly categorized
5 min read
Importance of Vaccines, Vaccination and ImmunizationVaccination and immunization play a crucial role in protecting individuals and communities from infectious diseases. They help to stimulate the immune system and prepare it to recognize and fight off specific pathogens. Vaccination classes 6 and 12 are important topics frequently asked in examinatio
7 min read
Alcohol and Drug Abuse Prevention ControlAs opposed to the normal thoughts pervasive in general society, substance use is very far-reaching. So is substance misuse. It's anything but a little issue, confined to the domain of the feeble and detestable. The utilization of medications rises above race, orientation, age, or financial status. T
10 min read
Chapter 8: Microbes In Human Welfare
Microbes in Human Welfare NotesCBSE Class 12 Chapter 8 Microbes in Huaman Welfare: Microbes are the smallest living organisms that can only be seen under the microscope. Microbes are found everywhere. Examples- are air, water, soil, inside and outside the bodies of plants and animals, thermal vents (1000 degree Celsius), under th
6 min read
Microbes In Human WelfareMicrobes are microscopic organisms, that can be classified under protozoa, bacteria, fungi, and microscopic plants viruses, viroid, and prions (proteinaceous infectious agents). They are present everywhere– in soil, water, and air, inside our bodies, animals, and plants. Not only in life forms, but
6 min read
BiofertilizersBiofertilizers are biologically active substances that help in enriching the soil's fertility. Biofertilizers are microbes or microbial products. It helps to reduce the use of chemical fertilizers. Reducing the use of chemical fertilizers from the environment biofertilizers helps to protect the ecos
8 min read